View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_low_66 (Length: 218)
Name: NF10342_low_66
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_low_66 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 11 - 203
Target Start/End: Complemental strand, 6057708 - 6057516
Alignment:
| Q |
11 |
tgagatgaacattcttcttccaaagttagaatattttcgactagaaaactgtccagaaattgaatcatttcccgaaagtggtatgccacctaagttgaga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6057708 |
tgagatgaacattcttcttccaaagttagaatatttccgactagaaaactgtccagaaattgaatcattccccgaaagtggtatgccacctaagttgaga |
6057609 |
T |
|
| Q |
111 |
tcgattcgcatcatgaattgcgagaaactacttactggcctgtcctggccttccatgaacatgcttactgatgtaacaattcaaggtccatgt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6057608 |
tcgattcgcatcatgaattgcgagaaactacttactggtctgtcctggccttccatggacatgcttactgatgtaacaattcaaggtccatgt |
6057516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University