View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_low_67 (Length: 216)
Name: NF10342_low_67
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_low_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 28 - 203
Target Start/End: Complemental strand, 25639359 - 25639184
Alignment:
| Q |
28 |
ctgcatccttctcatcggttgcgcccgcctcttcctcagtcgcttatgctggtgcacctgccactgctgcacatgtaacatacctcacatccacttgaat |
127 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25639359 |
ctgcatccttctcatcggtcgcgcccgcctcttcctcagtcgcttatgctggtgcacctgccactgctgcacatgtaacatacctcacatccacttgaat |
25639260 |
T |
 |
| Q |
128 |
ggatctctccgagtttagactttataacgttgaataaagtataccatatgcaacatagtatttcaatatttcatct |
203 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25639259 |
ggatctcgccgagtttagactttataacgttgaataaagtataccatatgcaacatagtatttcaatatttcatct |
25639184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 69 - 132
Target Start/End: Complemental strand, 37398855 - 37398793
Alignment:
| Q |
69 |
gcttatgctggtgcacctgccactgctgcacatgtaacatacctcacatccacttgaatggatc |
132 |
Q |
| |
|
|||||||| |||| |||| |||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
37398855 |
gcttatgccggtgggcctgtcactgctgcacaagtaacatacctcac-tccacttgaatggatc |
37398793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 84 - 129
Target Start/End: Complemental strand, 42403683 - 42403638
Alignment:
| Q |
84 |
cctgccactgctgcacatgtaacatacctcacatccacttgaatgg |
129 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| ||| |||||||||| |
|
|
| T |
42403683 |
cctgccactgctccacaggtaacatacctcatatcaacttgaatgg |
42403638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University