View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_low_69 (Length: 210)
Name: NF10342_low_69
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_low_69 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 21 - 196
Target Start/End: Original strand, 41440978 - 41441152
Alignment:
| Q |
21 |
aacgtggtggccaagatttgagtgttatgtggttgaaggaagaaactaggaaatgtgacaaaaacgattcaaagagacaacaagaacaaggttcatgttt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41440978 |
aacgtggtggccaagatttgagtgttatgtggttgaaggaagaaactaggaaatgtgactaaaacgattcaaagagacaacaagaacaaggttcatgttt |
41441077 |
T |
 |
| Q |
121 |
tttcactactatgaagagtgaaaataattgtagaattttcaacatcatatactacaaaaaatacaactccaacgtc |
196 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41441078 |
tttcactactatgaagagtg-aaataattgtagaattttcaacatcatatactacaaaaaatgcaactccaacgtc |
41441152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 21 - 141
Target Start/End: Original strand, 41454133 - 41454252
Alignment:
| Q |
21 |
aacgtggtggccaagatttgagtgttatgtggttgaaggaagaaactaggaaatgtgac-aaaaacgattcaaagagacaacaagaacaagg--ttcatg |
117 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||| |||||||||| | || || |
|
|
| T |
41454133 |
aacgtggtagccaagatttgagtgtta-gtggttgaaggaagaaactaggaaatgtgacaaaaaacgattgaaagag---acaagaacaaagatttggtg |
41454228 |
T |
 |
| Q |
118 |
ttttttcactactatgaagagtga |
141 |
Q |
| |
|
|||||| ||||||||||||||||| |
|
|
| T |
41454229 |
ttttttaactactatgaagagtga |
41454252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 146 - 196
Target Start/End: Original strand, 41457247 - 41457297
Alignment:
| Q |
146 |
aattgtagaattttcaacatcatatactacaaaaaatacaactccaacgtc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
41457247 |
aattgtagaattttcaacatcatatactacaaacaatgcaactccaacgtc |
41457297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University