View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10343_high_4 (Length: 236)
Name: NF10343_high_4
Description: NF10343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10343_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 51 - 222
Target Start/End: Complemental strand, 17602311 - 17602140
Alignment:
| Q |
51 |
ttcttctgcttggagcattatgttcgtgcgtattggcttttgaattggtgtagtggagtaaactgttctggttgtgtgatggattgaatgtagccgtatt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17602311 |
ttcttctgcttggagcattatgttcgtgcgtattggcttttgaattggtgtagtggagtaaactgttctggttgtgtgatggattgaatgtagccgtatt |
17602212 |
T |
|
| Q |
151 |
tattttcatggttaaggtttgatcacaagaaccttaactatgttcggttgtaatatttatctttgcataaac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17602211 |
tattttcatggttaaggtttgatcacaagaaccttaactatgttcggttgtaatatttatctttgcataaac |
17602140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 17602388 - 17602341
Alignment:
| Q |
1 |
attggttgaattaattctgaccttggttattttatatattggatggtt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17602388 |
attggttgaattaattctgaccttggttattttatatattggatggtt |
17602341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 153 - 194
Target Start/End: Complemental strand, 34851897 - 34851856
Alignment:
| Q |
153 |
ttttcatggttaaggtttgatcacaagaaccttaactatgtt |
194 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
34851897 |
ttttcgtggttatggtttgatcacaagaaccttaaccatgtt |
34851856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University