View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10343_low_8 (Length: 240)
Name: NF10343_low_8
Description: NF10343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10343_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 8 - 215
Target Start/End: Complemental strand, 17602958 - 17602752
Alignment:
| Q |
8 |
ataaagaattttctttggaatttgataacgtgtagactttgatgttaattgaactttaatccttgaagtgatgcttttgttggggataacttgttgggaa |
107 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17602958 |
ataaagaattttctttggattttgataacgtgtagactttgatgttgattgaactttaatccttgaagtgatgcttttgttggggataacttgttgggaa |
17602859 |
T |
 |
| Q |
108 |
ttattaatggagagtatggttgatgttaaattttggtgaagaccttaaatagttattagtagggataagtagaaatatcagtagaattaagtttagtaga |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17602858 |
ttattaatggagagtatggttgatgttaaattttggtgaagaccttaaatagttattagta-ggataagtagaaatatcagtagaattaagtttagtaga |
17602760 |
T |
 |
| Q |
208 |
aagtctaa |
215 |
Q |
| |
|
|||||||| |
|
|
| T |
17602759 |
aagtctaa |
17602752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 205 - 240
Target Start/End: Complemental strand, 17602616 - 17602581
Alignment:
| Q |
205 |
agaaagtctaagattataagttgttttgatagaatt |
240 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17602616 |
agaaagtccaagattataagttgttttgatagaatt |
17602581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University