View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10344_7 (Length: 397)
Name: NF10344_7
Description: NF10344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10344_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 8682744 - 8682843
Alignment:
| Q |
1 |
gtgatgacaacaaaacggccaatgaaggcggtggtaaaaatgcaggtggtggcacaaaagtagaggaagtgaagccagcaccacagccagtgaacgagca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8682744 |
gtgatgacaacaaaacggccaatgaaggcggtggtaaaaatgcaggtggtggctcaaaagtagaggaagtgaagccagcaccacagccagtgaaagagca |
8682843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 72; Significance: 1e-32; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 150 - 301
Target Start/End: Complemental strand, 14606924 - 14606773
Alignment:
| Q |
150 |
tttcaagaatcaagggaatatgaaatgcattttatcatgcaagaccttctcaatgatttggcaaaatatgtatgcggggatttttgctttacattcaaac |
249 |
Q |
| |
|
||||| ||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||| |||||||| ||||| |||||||||| ||| ||||| |
|
|
| T |
14606924 |
tttcaggaatcaagggaatatgagatggattttatcatgcatgaccttctcaatgatttggctaaatatgtgtgcggtgatttttgctcaacactcaaag |
14606825 |
T |
 |
| Q |
250 |
ataaggagtcacatcatatattgaaaaccactcgccatttgtcatttttagg |
301 |
Q |
| |
|
|| |||| || ||| | | |||||||| ||||||||| ||||||||||||| |
|
|
| T |
14606824 |
atgaggaatctcataacagattgaaaatgactcgccatgtgtcatttttagg |
14606773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 172 - 244
Target Start/End: Original strand, 14312019 - 14312091
Alignment:
| Q |
172 |
aaatgcattttatcatgcaagaccttctcaatgatttggcaaaatatgtatgcggggatttttgctttacatt |
244 |
Q |
| |
|
||||||| ||||| ||||| ||||||||||||||||||||||||| |||| | |||||||||| ||||||||| |
|
|
| T |
14312019 |
aaatgcaatttataatgcatgaccttctcaatgatttggcaaaatgtgtaagtggggatttttcctttacatt |
14312091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 14296939 - 14296983
Alignment:
| Q |
179 |
ttttatcatgcaagaccttctcaatgatttggcaaaatatgtatg |
223 |
Q |
| |
|
|||| ||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
14296939 |
ttttgtcatgcatgatcttctcaatgatttggcaaaatatgtatg |
14296983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University