View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10344_low_3 (Length: 237)
Name: NF10344_low_3
Description: NF10344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10344_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 2 - 201
Target Start/End: Complemental strand, 35478666 - 35478467
Alignment:
| Q |
2 |
ttaatgatcttacacattgagtaaatgccattgacttgtaatctgtccactccaatggtacgtcttggcaacttttctttgctctgatttggtcatgctc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35478666 |
ttaatgatcttacacattgagtaaatgccattgacttgtaatctgtccactccaatggtacgtcttggcaacttttctttgctctgatttggtcatgctc |
35478567 |
T |
 |
| Q |
102 |
ttcctaccaaaacaaaacacaaaccaagtctcttatcaaactccctagtataggaacttaggattattatataattgaccacacaatgcaattctcaatt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35478566 |
ttcctaccaaaacaaaacacaaaccaagtctcttatcaaactccctagtataggaacttaggattattatataattgaccacacaatgcaattcttaatt |
35478467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 10 - 55
Target Start/End: Complemental strand, 31556890 - 31556845
Alignment:
| Q |
10 |
cttacacattgagtaaatgccattgacttgtaatctgtccactcca |
55 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
31556890 |
cttacacattgagtaaatgtcattgacttgtaatctgtccattcca |
31556845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University