View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10345_high_8 (Length: 249)
Name: NF10345_high_8
Description: NF10345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10345_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 21 - 239
Target Start/End: Original strand, 37539937 - 37540157
Alignment:
| Q |
21 |
tggtgatgtgtgggggcagagggttgttggaaatgatgaggaagttgttttgggtttgaggtcctttgacgcatgataatgtggctaagtttagacaagg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37539937 |
tggtgatgtgtgggggcagagggttgttggaaatgatgaggaagttgttttgggtttgaggtcctttgacgcatgataatgtggctaagtttagacaagg |
37540036 |
T |
 |
| Q |
121 |
aaagtgttcttcattctgttcccaaaacaaacatggttctgatggttatagta--nnnnnnnnnctatagattctttcaatgagaaatgattttatttaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37540037 |
aaagtgttcttcattctgttcccaaaacaaacatggttctgatggttatagtatttttttttttctatagattctttcaatgagaaatgattttatttaa |
37540136 |
T |
 |
| Q |
219 |
gtcaatcttgaacgcttagca |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37540137 |
gtcaatcttgaacgcttagca |
37540157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University