View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10345_low_13 (Length: 260)
Name: NF10345_low_13
Description: NF10345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10345_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 33385294 - 33385546
Alignment:
| Q |
1 |
tacacctggaaacaagtttttgacattatttcatctgatgcaatgtgcaaaggtaagtgaattttgtc-------aaaatccagatatttctaattttgg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33385294 |
tacacctggaaacaagtttttgacattatttcatctgatgcaatgtgcaaaggtaagtgaattttgtcttgcgtgaaaatccagatatttctaattttgg |
33385393 |
T |
 |
| Q |
94 |
acaataatgatcaaaaccaaaattttgaaactggacccacaatcttgctgggtgaatgactgttgtttaaggcatgtgactgatattgatgtgtatgtgt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33385394 |
acaataatgatcaaaaccaaaattttgaaactggacccacaatcttgctgggtgaatgactgttgtttaaggcatgtgactgatattgatgtgtatgtgt |
33385493 |
T |
 |
| Q |
194 |
caatgtagttggcccaataactgttgcgcaaggcatgtgcctcatactgatgt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33385494 |
caatgtagttggcccaataactgttgcgctaggcatgtgcctcatactgatgt |
33385546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University