View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10345_low_18 (Length: 216)
Name: NF10345_low_18
Description: NF10345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10345_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 22 - 199
Target Start/End: Complemental strand, 49282833 - 49282656
Alignment:
| Q |
22 |
agagggaggattgttggaaaatataggtggagcataaacttccctttgtttttcttcttgcaaaatgagggaaaaacacattagttatgggatgaatggg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49282833 |
agagggaggattgttggaaaatataggtggagcaaaaacttccctttgtttttcttcttgcaaaatgagggaaaaacacattagttatgggaggaatggg |
49282734 |
T |
 |
| Q |
122 |
atcaatggacttccctttgttccatctggttgtaatctcaccaaggttgaatgccaccatcaatttaaactaagtctt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49282733 |
atcaatggacttccctttgttccatctggttgtaatctcaccaaggttgaatgccaccatcaatttaaactaagtctt |
49282656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University