View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10346_high_20 (Length: 343)

Name: NF10346_high_20
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10346_high_20
NF10346_high_20
[»] chr1 (3 HSPs)
chr1 (197-282)||(4203006-4203091)
chr1 (98-165)||(4202907-4202974)
chr1 (300-328)||(4203097-4203125)


Alignment Details
Target: chr1 (Bit Score: 82; Significance: 1e-38; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 197 - 282
Target Start/End: Original strand, 4203006 - 4203091
Alignment:
197 atgtagctacaataacacgatgagttgttatcttcaatcttctcaattgttgttgttgtttggttgcatgtgccaccatccaattc 282  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
4203006 atgtagctacaataacacgatgagttgttatcttcaatcttctcaattgctgttgttgtttggttgcatgtgccaccatccaattc 4203091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 98 - 165
Target Start/End: Original strand, 4202907 - 4202974
Alignment:
98 ttgttttaccaagaagattgcgcaagtcagcgaattggtggtgagtgggagagcgtggaattttggga 165  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4202907 ttgttttaccaagaagattgcgcaagtcagcgaattggtggtgagtgggagagcgtggaattttggga 4202974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 328
Target Start/End: Original strand, 4203097 - 4203125
Alignment:
300 catcatcatcactttctcttgcttttttc 328  Q
    |||||||||||||||||||||||||||||    
4203097 catcatcatcactttctcttgcttttttc 4203125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University