View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10346_high_20 (Length: 343)
Name: NF10346_high_20
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10346_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 1e-38; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 197 - 282
Target Start/End: Original strand, 4203006 - 4203091
Alignment:
| Q |
197 |
atgtagctacaataacacgatgagttgttatcttcaatcttctcaattgttgttgttgtttggttgcatgtgccaccatccaattc |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4203006 |
atgtagctacaataacacgatgagttgttatcttcaatcttctcaattgctgttgttgtttggttgcatgtgccaccatccaattc |
4203091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 98 - 165
Target Start/End: Original strand, 4202907 - 4202974
Alignment:
| Q |
98 |
ttgttttaccaagaagattgcgcaagtcagcgaattggtggtgagtgggagagcgtggaattttggga |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4202907 |
ttgttttaccaagaagattgcgcaagtcagcgaattggtggtgagtgggagagcgtggaattttggga |
4202974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 328
Target Start/End: Original strand, 4203097 - 4203125
Alignment:
| Q |
300 |
catcatcatcactttctcttgcttttttc |
328 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4203097 |
catcatcatcactttctcttgcttttttc |
4203125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University