View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10346_high_41 (Length: 243)

Name: NF10346_high_41
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10346_high_41
NF10346_high_41
[»] chr4 (2 HSPs)
chr4 (131-225)||(39794631-39794725)
chr4 (1-77)||(39794773-39794848)


Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 131 - 225
Target Start/End: Complemental strand, 39794725 - 39794631
Alignment:
131 aaggtaagtgttcgaaactagatatttatttattgaatttttaaccaataagatacttcacaaaacaaattgagttatttaacattatagctaga 225  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39794725 aaggtaagtgttcgaaactagatatttatttattgaatttttaaccaataagatacttcacaaaacaaattgagttatttaacattatagctaga 39794631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 39794848 - 39794773
Alignment:
1 ctttagtaactaagataagtttacaggacacaaggaaaacagtttagttatggtctcccattagtttagattagttg 77  Q
    ||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||    
39794848 ctttagtaactgagataagtttacagtacacaaggaaa-cagtttagttatggtctcccattagtttagattagttg 39794773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University