View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10346_high_41 (Length: 243)
Name: NF10346_high_41
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10346_high_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 131 - 225
Target Start/End: Complemental strand, 39794725 - 39794631
Alignment:
| Q |
131 |
aaggtaagtgttcgaaactagatatttatttattgaatttttaaccaataagatacttcacaaaacaaattgagttatttaacattatagctaga |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39794725 |
aaggtaagtgttcgaaactagatatttatttattgaatttttaaccaataagatacttcacaaaacaaattgagttatttaacattatagctaga |
39794631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 39794848 - 39794773
Alignment:
| Q |
1 |
ctttagtaactaagataagtttacaggacacaaggaaaacagtttagttatggtctcccattagtttagattagttg |
77 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39794848 |
ctttagtaactgagataagtttacagtacacaaggaaa-cagtttagttatggtctcccattagtttagattagttg |
39794773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University