View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10346_high_42 (Length: 242)
Name: NF10346_high_42
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10346_high_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 225
Target Start/End: Original strand, 3899316 - 3899528
Alignment:
| Q |
13 |
gtgggggttgcagtggtttttcttcctcttccaaccatcgaaaaatgttgaaaagatatgagaatcaataaataatttccacaaacggcactaataattt |
112 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3899316 |
gtgggggttgcagtggtttttctttctcttccaaccatcgaaaaatgttgaaaagatatgagaatcaataaataatttccacaaacagcactaataattt |
3899415 |
T |
|
| Q |
113 |
agagtggacttgaagacgacaatttaaaattgctctaacacgatggaggatcgatgttgatcagcaaaatgagcggtgtacctgattccaacgcataagc |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
3899416 |
agagtggacttgaagacaacaatttaaaattgctctaacacgatggaggatcgatgttgatcagcaaaatgagtggtgtacctgattccaacgcttaagc |
3899515 |
T |
|
| Q |
213 |
cggtgagggtttt |
225 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3899516 |
cggtgagggtttt |
3899528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University