View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10346_high_43 (Length: 241)
Name: NF10346_high_43
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10346_high_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 40809582 - 40809807
Alignment:
| Q |
1 |
atcactcctttgcttacacctgtagtacccgaggaatacaacaacgccgccgtatcggtttgtttcacgtcaatttttggaaattcggttgctgattcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40809582 |
atcactcctttgcttacacctgtagtacccgaggaatacaacaacgccgccgtatcggtttgtttcacgtcaatttttggaaattcggttgctgattcac |
40809681 |
T |
|
| Q |
101 |
cgagtttcacaaacgattcgaaactcgtaactgtatccggcgttgcaacgccggaggaattgagaaaaacggccgggatattgaggtgatttactttctg |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40809682 |
cgagtttgacaaacgattcgaaactcgtaactgtatccggcgttgcaacgccggaggaattgagaaaaacggcggggatattgaggtgatttactttctc |
40809781 |
T |
|
| Q |
201 |
ccataattcagcgacggtgataatga |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40809782 |
ccataattcagcgacggtgataatga |
40809807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University