View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10346_high_44 (Length: 241)
Name: NF10346_high_44
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10346_high_44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 15 - 219
Target Start/End: Original strand, 6283846 - 6284050
Alignment:
| Q |
15 |
agcagagaaggataggtttttccaataacacctccattgattatagatagaggaagggggtactatagttccagaaacacctggaggaaatgtggaggga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6283846 |
agcagagaaggataggtttttccaataacaccgccattaattatagatagaggaagggggtacgatagttctggaaacacctggaggaaatgtggaggga |
6283945 |
T |
|
| Q |
115 |
gagtatgtaggaaatagttggatgcggtagggatttttcgttgacaaaggaatgacaaaatttattttaatatagaggatgaaacaatacttaagaagtc |
214 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6283946 |
gagtaggtaggaaatagttggatgcagtagggatttttcgcttacaaaggaatgacaaaatttattttaatatagaggatgaaacaatacttaagaagtc |
6284045 |
T |
|
| Q |
215 |
ggtag |
219 |
Q |
| |
|
||||| |
|
|
| T |
6284046 |
ggtag |
6284050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University