View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10346_high_47 (Length: 238)
Name: NF10346_high_47
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10346_high_47 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 11 - 238
Target Start/End: Original strand, 26069095 - 26069322
Alignment:
| Q |
11 |
cagagatcgatttcttccaccactaccggagtttccgccgccggcgttgtaagacagaaatcttcacgtagtagtcaaagaaagaagaaaactggtttca |
110 |
Q |
| |
|
|||||||||||||||||||| |||| || || |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26069095 |
cagagatcgatttcttccactgctactggcgtctccgccgccggcgttgtaagacagaaatcttcacgtagtactcaaagaaagaagaaaactggtttca |
26069194 |
T |
|
| Q |
111 |
tcgaaagtgtttgctcgattttcaggagtcaccggagagagaaaactgttcagaaatcgaatcttccggtggaagattcttcaacgaagaagaagagaaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26069195 |
tcgaaagtgtttgctcgattttcaggagtcaccggagagagaaaactgttcagaaatcgaatcctccggtggaagattcttcaacgaagaagaagagaaa |
26069294 |
T |
|
| Q |
211 |
caatggaagaaaaacgcgggaaggaagt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
26069295 |
caatggaagaaaaacgcgggaaggaagt |
26069322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University