View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10346_low_15 (Length: 422)
Name: NF10346_low_15
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10346_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 2e-40; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 42219598 - 42219514
Alignment:
| Q |
1 |
cgttgcttgagaggaaggcgaagggacgtgctgccgctgataaggagaagggtactaagtttggtgctgaagatattatgcagaa |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42219598 |
cgttgcttgagaggaaggcgaagggacgtgctgccgctgataaggagaagggtactaagtttggtgctgaagatattatgcagaa |
42219514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 312 - 375
Target Start/End: Complemental strand, 42219309 - 42219246
Alignment:
| Q |
312 |
caatgttgtgaaaagaaaagaaatttagggttgagacctctctagggtcgatacttttgattga |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42219309 |
caatgttgtgaaaagaaaagaaatttagggttgagacctctctagggtcgatacttttgattga |
42219246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 15 - 82
Target Start/End: Original strand, 5404546 - 5404613
Alignment:
| Q |
15 |
aaggcgaagggacgtgctgccgctgataaggagaagggtactaagtttggtgctgaagatattatgca |
82 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |||||||| ||||||| | ||||||| |||||||| |
|
|
| T |
5404546 |
aaggcgaagggtcgtgctgctgctgataaggaaaagggtaccaagtttgctcctgaagacattatgca |
5404613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 15 - 84
Target Start/End: Complemental strand, 3085306 - 3085237
Alignment:
| Q |
15 |
aaggcgaagggacgtgctgccgctgataaggagaagggtactaagtttggtgctgaagatattatgcaga |
84 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
3085306 |
aaggctaagggtcgtgctgctgctgataaggagaagggtactaagtttgctcctgaggatattatgcaga |
3085237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University