View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10346_low_25 (Length: 342)

Name: NF10346_low_25
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10346_low_25
NF10346_low_25
[»] chr8 (1 HSPs)
chr8 (37-70)||(20515595-20515628)


Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 37 - 70
Target Start/End: Complemental strand, 20515628 - 20515595
Alignment:
37 catctctggaagcatcttcaatcattcaacttct 70  Q
    ||||||||||||||||||||||||||||||||||    
20515628 catctctggaagcatcttcaatcattcaacttct 20515595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University