View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10346_low_25 (Length: 342)
Name: NF10346_low_25
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10346_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 37 - 70
Target Start/End: Complemental strand, 20515628 - 20515595
Alignment:
| Q |
37 |
catctctggaagcatcttcaatcattcaacttct |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
20515628 |
catctctggaagcatcttcaatcattcaacttct |
20515595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University