View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10346_low_30 (Length: 324)
Name: NF10346_low_30
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10346_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 3364678 - 3364929
Alignment:
| Q |
1 |
ctcataggaacaaattttctttgaatgatcccaacctagattttctttagtttaaaaacatttactattttgatgtgttgtttttggtttctttaactcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3364678 |
ctcataggaacaaattttctttgaatgatcccaacctagattttctttagtttaaaaacatttactattttgatgtgttgtttttggtttctttaactcc |
3364777 |
T |
|
| Q |
101 |
agcagaagtttatttcaacaagcaagaatgttctttgtctatgaccagttgctttggttgcaataattcagttttattcattttaatatctccaaatggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3364778 |
agcagaagtttatttcaacaagcaagaatgttctttgtctatgaccagttgctttggttgcaataattcagttttattcattttaatatctccaaatggc |
3364877 |
T |
|
| Q |
201 |
atcaataatgtgtataaaatttgtaacaattgtcattgatatgtccactatc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3364878 |
atcaataatgtgtataaaatttgtaacaattgtcattgatatgtccactatc |
3364929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University