View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10346_low_48 (Length: 252)

Name: NF10346_low_48
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10346_low_48
NF10346_low_48
[»] chr7 (1 HSPs)
chr7 (99-252)||(36735872-36736031)


Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 99 - 252
Target Start/End: Complemental strand, 36736031 - 36735872
Alignment:
99 tcaatttaacatggactaatactaatgttaaaactttt-atagtgactaaaacatgtcacnnnnnnnn--atgtggaataatgcaaaatt---taatata 192  Q
    ||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||          ||||||||||||||||||||   |||||||    
36736031 tcaatttaacatggactaaaactaatgttaaaactttttatagtgactaaaacatgtcactttttttttaatgtggaataatgcaaaattatttaatata 36735932  T
193 tttataagaattaaaaacttatttaaattattcaagtgaactacgattttatagatattc 252  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
36735931 tttataaaaattaaaaacttatttaaattattcaagtgaactacgattttatagatattc 36735872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University