View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10346_low_48 (Length: 252)
Name: NF10346_low_48
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10346_low_48 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 99 - 252
Target Start/End: Complemental strand, 36736031 - 36735872
Alignment:
| Q |
99 |
tcaatttaacatggactaatactaatgttaaaactttt-atagtgactaaaacatgtcacnnnnnnnn--atgtggaataatgcaaaatt---taatata |
192 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
36736031 |
tcaatttaacatggactaaaactaatgttaaaactttttatagtgactaaaacatgtcactttttttttaatgtggaataatgcaaaattatttaatata |
36735932 |
T |
 |
| Q |
193 |
tttataagaattaaaaacttatttaaattattcaagtgaactacgattttatagatattc |
252 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36735931 |
tttataaaaattaaaaacttatttaaattattcaagtgaactacgattttatagatattc |
36735872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University