View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10346_low_49 (Length: 251)
Name: NF10346_low_49
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10346_low_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 45345229 - 45344992
Alignment:
| Q |
1 |
atggtaaacaaagggatgaaaatttggttttaagtggttgtcattttgataatggaggtgatcaaaaccaaaaaactgtttcagatagagaaaacttatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45345229 |
atggtaaacaaagggatgaaaatttggttttaagtggctgtcattttgataatggaggtgatcaaaaccaaaaaactgtttcagatcgagaaaacttatc |
45345130 |
T |
|
| Q |
101 |
actgagacaggatattgttcgacctgtcgaagcaatttgtggtggtgaccttgaaagtgagatggaagaccaacaaaaccatcctaatttgggcaaagga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45345129 |
actgagacaggatattgttcgacctgtcgaagcaatttgtggtggtgaccttgaaagtgagatggaagaccaacaaaaccatcctaatttgggcaaagga |
45345030 |
T |
|
| Q |
201 |
gacagtctggtggggaatgatcaagccaatagttcttc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45345029 |
gacagtctggtggggaatgatcaagccaatagttcttc |
45344992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University