View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10346_low_51 (Length: 250)
Name: NF10346_low_51
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10346_low_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 10606017 - 10606138
Alignment:
| Q |
1 |
cactacaagaaagttcgcgtgttagtagggatattgtggtatttagaaaatgaagtttgaaccttgaattctcaacttatttatttttagaggtaatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||| |||||||||||||||| |
|
|
| T |
10606017 |
cactacaagaaagttcgcgtgttagtagggatattgtggtatttagggaatgaagtttgaactttaaattctcaacttatttacttttagaggtaatttt |
10606116 |
T |
|
| Q |
101 |
tcgtcactaaactacttgacaa |
122 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
10606117 |
tcgccactaaactacttgacaa |
10606138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 163 - 240
Target Start/End: Original strand, 10606827 - 10606904
Alignment:
| Q |
163 |
attgatttacaagattcaatctttactttcactttctgaaaattatcttcactactttcactttttacacatcctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10606827 |
attgatttacaagattcaatctttactttcactttctgaaaattatcttcactattttcactttttacacatcctttg |
10606904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University