View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10346_low_58 (Length: 239)
Name: NF10346_low_58
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10346_low_58 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 17 - 231
Target Start/End: Complemental strand, 29103782 - 29103568
Alignment:
| Q |
17 |
accttggatggagggtaattaggtgtggatccataattgggaaatgatgaagatattggaagactgagtaagtcttctgataagaattgtgtccaaattc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| | |
|
|
| T |
29103782 |
accttggatggagggtaattaggtgtggatccataattgggaaatgatgaagatattggaagactgagcaagtcttctgataagaactgtgtccaaatcc |
29103683 |
T |
|
| Q |
117 |
catcatcccttgtgatattcccaccattgttatttagagtattagtcccattgttttgggatgtgcttggatcccatggcatcaaataatttgaggtccc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29103682 |
catcatcccttgtgatattcccaccattgttatttagagtattagtcccattgttttgggatgtgcttggatcccatggcatcaaataatttgaggtccc |
29103583 |
T |
|
| Q |
217 |
tataacttcatctct |
231 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29103582 |
tataacttcatctct |
29103568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University