View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10346_low_63 (Length: 230)
Name: NF10346_low_63
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10346_low_63 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] scaffold0181 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 7 - 230
Target Start/End: Original strand, 36735513 - 36735736
Alignment:
| Q |
7 |
aaaggtggtaatgggattgttaatatggaagagaaacctgggttgaccctttcaagggctcatcctttaatttgtgtccctgtgcctagatttaatcctt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36735513 |
aaaggtggtaatgggattgttaatatggaagagaaacctgggttgaccctttcaagggctcatcctttaatttgtgtccctgtgcctagatttaatcatt |
36735612 |
T |
 |
| Q |
107 |
ttccttctatgtgattttgatcatgtttaggggaggnnnnnnnntgcaacttcatattgaaaatttatatttttagtcctcttgttgctttgtggtattc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36735613 |
ttccttctatgtgattttgatcatgtttaggggaggaaaaaaaatgcaacttcatattgaaaatttatatttttagtcctcttgttgctttgtggtattc |
36735712 |
T |
 |
| Q |
207 |
ataaatcataactatcattttctt |
230 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36735713 |
ataaatcataactatcattttctt |
36735736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 92
Target Start/End: Original strand, 25169643 - 25169723
Alignment:
| Q |
12 |
tggtaatgggattgttaatatggaagagaaacctgggttgaccctttcaagggctcatcctttaatttgtgtccctgtgcc |
92 |
Q |
| |
|
||||||||||| ||| | |||||||||||||| | |||||||| |||||||||||||||| |||||||| |||||||| |
|
|
| T |
25169643 |
tggtaatgggaaagttgacatggaagagaaaccggccgtgacccttccaagggctcatcctttgatttgtgttcctgtgcc |
25169723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 12 - 92
Target Start/End: Original strand, 24941207 - 24941287
Alignment:
| Q |
12 |
tggtaatgggattgttaatatggaagagaaacctgggttgaccctttcaagggctcatcctttaatttgtgtccctgtgcc |
92 |
Q |
| |
|
||||||||||| ||||| |||||||||||| | | | |||||| |||||||||||||||| |||||||| |||||||| |
|
|
| T |
24941207 |
tggtaatgggaaagttaacatggaagagaaatccgctgtaacccttccaagggctcatcctttgatttgtgttcctgtgcc |
24941287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0181 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0181
Description:
Target: scaffold0181; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 87
Target Start/End: Complemental strand, 9630 - 9568
Alignment:
| Q |
25 |
gttaatatggaagagaaacctgggttgaccctttcaagggctcatcctttaatttgtgtccct |
87 |
Q |
| |
|
||||| |||||||||||||| | ||||||||| | |||||||||||||| || ||||||||| |
|
|
| T |
9630 |
gttaacatggaagagaaaccagctttgacccttcctagggctcatcctttgatgtgtgtccct |
9568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University