View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10346_low_68 (Length: 216)
Name: NF10346_low_68
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10346_low_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 40826989 - 40826809
Alignment:
| Q |
17 |
gagatcgatgttgcccgcttcaagaatataaagtaatataattttcatgctatagcatgactatatgtatttagtttctttcacnnnnnnnntatattta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
40826989 |
gagatcgatgttgcccgcttcaagaatataaagtaatataattttcatgctatagcatgactatatatatttagtttctttcacaaaaaaaa-atattta |
40826891 |
T |
 |
| Q |
117 |
gttgttcatcctataatattattgtatttaataatattagcaagtcattgtgatttgtttgtgttattgagtatggttttat |
198 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40826890 |
gttgttcatcctataatattatagtatttaataatattagcaagtcattgtgatttgtttgtgttattgagtatggttttat |
40826809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University