View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10346_low_69 (Length: 211)
Name: NF10346_low_69
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10346_low_69 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 98 - 203
Target Start/End: Original strand, 19118993 - 19119094
Alignment:
| Q |
98 |
atttgcataacataagaatcaatattaactaataaataaatttcaaatatactcaaatgttttatcgatctactaaccaatttacattatctcttagctc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19118993 |
atttgcataacataagaatcaatattaactaataaataaatttcaaatatactcaaatgttttatcgatct----accaatttacattatctcttagctc |
19119088 |
T |
|
| Q |
198 |
tctgct |
203 |
Q |
| |
|
| |||| |
|
|
| T |
19119089 |
tttgct |
19119094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 54
Target Start/End: Original strand, 19118907 - 19118943
Alignment:
| Q |
19 |
gtatcatgtcgatatgaatccc-aaaaaacaaaatct |
54 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19118907 |
gtatcatgtcgatatgaatcccaaaaaaacaaaatct |
19118943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University