View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10347_high_19 (Length: 250)

Name: NF10347_high_19
Description: NF10347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10347_high_19
NF10347_high_19
[»] chr7 (3 HSPs)
chr7 (1-240)||(39789985-39790224)
chr7 (149-233)||(39411547-39411631)
chr7 (3-61)||(39411722-39411780)


Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 39789985 - 39790224
Alignment:
1 ttgcacttgagaccattccatctttctctctttctaagcgaaccggcttgcgtgaagaagaggaagatgtggaagaaagtgatattgaagatgaagaaag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
39789985 ttgcacttgagaccattccatctttctctctttctaagcgaaccggcttgcgtgaagaagaggaagatgtggaagaaagtgatattgaagatgaagaagg 39790084  T
101 ctatgatgagttcagtgtgatgaatagaatgatgcagagtgaagaagtggatagagtttgcagggtgagttttgatgaggagggagagtttggtgataat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39790085 ctatgatgagttcagtgtgatgaatagaatgatgcagagtgaagaagtggatagagtttgcagggtgagttttgatgaggagggagagtttggtgataat 39790184  T
201 gagatgtatcttgcaaagggacttggtgttgatttctgtg 240  Q
    ||||||||||||||||||||||||||||||||||||||||    
39790185 gagatgtatcttgcaaagggacttggtgttgatttctgtg 39790224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 149 - 233
Target Start/End: Complemental strand, 39411631 - 39411547
Alignment:
149 ggatagagtttgcagggtgagttttgatgaggagggagagtttggtgataatgagatgtatcttgcaaagggacttggtgttgat 233  Q
    ||||||||||| |||||||||||||| |||||||||| || ||||| |||| || ||||||||||||||||||||||||||||||    
39411631 ggatagagttttcagggtgagttttggtgaggagggaaaggttggtaataaagaaatgtatcttgcaaagggacttggtgttgat 39411547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 3 - 61
Target Start/End: Complemental strand, 39411780 - 39411722
Alignment:
3 gcacttgagaccattccatctttctctctttctaagcgaaccggcttgcgtgaagaaga 61  Q
    ||||| |||||||||||||||||||||||||| |||| ||| |||||||||||||||||    
39411780 gcactagagaccattccatctttctctctttcaaagcaaacaggcttgcgtgaagaaga 39411722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University