View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10347_high_19 (Length: 250)
Name: NF10347_high_19
Description: NF10347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10347_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 39789985 - 39790224
Alignment:
| Q |
1 |
ttgcacttgagaccattccatctttctctctttctaagcgaaccggcttgcgtgaagaagaggaagatgtggaagaaagtgatattgaagatgaagaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39789985 |
ttgcacttgagaccattccatctttctctctttctaagcgaaccggcttgcgtgaagaagaggaagatgtggaagaaagtgatattgaagatgaagaagg |
39790084 |
T |
 |
| Q |
101 |
ctatgatgagttcagtgtgatgaatagaatgatgcagagtgaagaagtggatagagtttgcagggtgagttttgatgaggagggagagtttggtgataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39790085 |
ctatgatgagttcagtgtgatgaatagaatgatgcagagtgaagaagtggatagagtttgcagggtgagttttgatgaggagggagagtttggtgataat |
39790184 |
T |
 |
| Q |
201 |
gagatgtatcttgcaaagggacttggtgttgatttctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39790185 |
gagatgtatcttgcaaagggacttggtgttgatttctgtg |
39790224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 149 - 233
Target Start/End: Complemental strand, 39411631 - 39411547
Alignment:
| Q |
149 |
ggatagagtttgcagggtgagttttgatgaggagggagagtttggtgataatgagatgtatcttgcaaagggacttggtgttgat |
233 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||| || ||||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
39411631 |
ggatagagttttcagggtgagttttggtgaggagggaaaggttggtaataaagaaatgtatcttgcaaagggacttggtgttgat |
39411547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 3 - 61
Target Start/End: Complemental strand, 39411780 - 39411722
Alignment:
| Q |
3 |
gcacttgagaccattccatctttctctctttctaagcgaaccggcttgcgtgaagaaga |
61 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||| ||| ||||||||||||||||| |
|
|
| T |
39411780 |
gcactagagaccattccatctttctctctttcaaagcaaacaggcttgcgtgaagaaga |
39411722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University