View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10347_high_26 (Length: 235)
Name: NF10347_high_26
Description: NF10347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10347_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 13 - 196
Target Start/End: Complemental strand, 16973044 - 16972860
Alignment:
| Q |
13 |
caaagggaggtgaaatattgtactcttt--gcttcaggtttcaatttccctaatttcaaaatccaacgtacaaagaattcttatctaagtaactcgcaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
16973044 |
caaagggaggtgaaatattgtactcttttagcttcaggtttcaatttccctaatttcaaaatccaacgtacaaagaatccttatctaactaactcgcaag |
16972945 |
T |
 |
| Q |
111 |
ttctcaacttcacaatcaatggactaatggttttcaaagagtaaaaggtagaagaatgagttttagagaagagaccgtgaaaactc |
196 |
Q |
| |
|
|| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
16972944 |
ttttcaacttcacaatcaat-aactaaaggttttcaaagagtaaaaggtagaagaatgagtttcagagaagagatcgtgaaaactc |
16972860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University