View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10347_low_18 (Length: 288)
Name: NF10347_low_18
Description: NF10347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10347_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 16 - 277
Target Start/End: Complemental strand, 39775877 - 39775616
Alignment:
| Q |
16 |
cattgatgacgtaatcacttagcatacacatcctttacgtaagaaacaaacaaacatcccttgtctggttacgttgttttatacgatagctttgaattgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775877 |
cattgatgacgtaatcacttagcatacacatcctttacgtaagaaacaaacaaaaatcccttgtctggttacgttgttttatacgatagctttgaattgg |
39775778 |
T |
 |
| Q |
116 |
taagtggaaaaaatcttcgtcattgtcaacaattggtaagatgcagactaatcatcagacaagaagattattggtataaatcattttcatgatgatttat |
215 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775777 |
taagtggaaaatatcttcgtcattgtcgacaattggtaagatgcagactaatcatcagacaagaagattattggtataaatcattttcatgatgatttat |
39775678 |
T |
 |
| Q |
216 |
tcaaaggaactttgttgggttgggtatccaaataatgcagcacaattgcacaaacatttcat |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775677 |
tcaaaggaactttgttgggttgggtatccaaataatgcagcacaattgcacaaacatttcat |
39775616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University