View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10347_low_19 (Length: 274)
Name: NF10347_low_19
Description: NF10347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10347_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 177 - 262
Target Start/End: Original strand, 27059816 - 27059901
Alignment:
| Q |
177 |
ttgtggatattatggaggtgttagatctttgttaaacaaaatggggcgtcataaacctcttcggtgttttgggttggaattaggaa |
262 |
Q |
| |
|
||||||||||| ||||||| ||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27059816 |
ttgtggatattctggaggtattagaactgtgttaaacaaaatggggcgtcataaacgtcttcggtgttttgggttggaattaggaa |
27059901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 32329665 - 32329717
Alignment:
| Q |
108 |
tttattatgacaagtgggagggtgtaggagaggggtataccacgtaagggtgt |
160 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||| |||| |||||||||| |
|
|
| T |
32329665 |
tttattgtgacaagtgggagggtgtatgagaggggtacaccatgtaagggtgt |
32329717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 108 - 177
Target Start/End: Original strand, 44682427 - 44682496
Alignment:
| Q |
108 |
tttattatgacaagtgggagggtgtaggagaggggtataccacgtaagggtgtttacctatcaactctct |
177 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
44682427 |
tttattgtgacaagtgggagggtgtaagagaggggtacaccacgtaagggtgtttacctatcagctctct |
44682496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 11 - 68
Target Start/End: Original strand, 44682310 - 44682368
Alignment:
| Q |
11 |
atgaacgggtggttggataagtgacaaaggtt-aaagaaaactgaatgctgaatgagag |
68 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44682310 |
atgaatgggtggttggataagtgacaaaggttgaaagaaaactgaatgctgaatgagag |
44682368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University