View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10347_low_20 (Length: 263)
Name: NF10347_low_20
Description: NF10347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10347_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 20 - 250
Target Start/End: Original strand, 2681458 - 2681688
Alignment:
| Q |
20 |
cgttgggtcacttctatcacccaatttctttcactttgcttcaggagcatacttatagcataaggaaccaaacaccctttagtgtttttgcagatgactt |
119 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2681458 |
cgttggttcacttctattacccaatttctttcactttgcttcaggagcatacttatagcataaggaaccaaacaccctttagtgtttttgcagatgactt |
2681557 |
T |
|
| Q |
120 |
cctatctttccacacttcttctggcattttgttaagttgtcttgttggacatctatttagaacttatgttgtgttgtcacaacttatctccaaaatgtat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2681558 |
cctatctttccacacttcttctggcattttgttaagttgtcttgttggacatctatttagaacttatgttgtgttgtcacaacttatctccaaaatgtat |
2681657 |
T |
|
| Q |
220 |
ttggtactttcttcattttcaacatgcttct |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2681658 |
ttggtactttcttcattttcaacatgcttct |
2681688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 121 - 185
Target Start/End: Complemental strand, 13125196 - 13125132
Alignment:
| Q |
121 |
ctatctttccacacttcttctggcattttgttaagttgtcttgttggacatctatttagaactta |
185 |
Q |
| |
|
|||||| |||| | || |||||| |||||||| || ||||||||||| ||||||||| ||||||| |
|
|
| T |
13125196 |
ctatctctccataattgttctggaattttgtttagctgtcttgttggtcatctattttgaactta |
13125132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University