View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10347_low_35 (Length: 239)
Name: NF10347_low_35
Description: NF10347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10347_low_35 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 9228951 - 9229173
Alignment:
| Q |
17 |
agattggacgtgtcactcataatcatcttccatcatccaaggacattggtgcatggactttcaagctgtcgtacccactaaattcatggttgctgctgct |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9228951 |
agattcgacgtgtcactcataatcatcttccatcatccaaggacattggtgcatggactttcaagctgtcgtacccactaaattcatggttgctgctgct |
9229050 |
T |
 |
| Q |
117 |
atcaccagtttcataattaaagttggatgacatcccctgaagcaaggattgagtttcatcgagatttatctctgattttgtccaagggtgcttctccatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9229051 |
atcaccagtttcataattaaagttggatgacaccccctgaagcaaggattgagtttcatcgagatttatctctgattttgtccaagggtgcttctccatt |
9229150 |
T |
 |
| Q |
217 |
aaccttaagccctctagctccat |
239 |
Q |
| |
|
|||||||| |||||||||||||| |
|
|
| T |
9229151 |
aaccttaacccctctagctccat |
9229173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University