View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10347_low_36 (Length: 238)
Name: NF10347_low_36
Description: NF10347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10347_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 22590394 - 22590171
Alignment:
| Q |
1 |
aaattgaaatggaacgcttttagcaaaaacaggggtgtgccc-tcggaaattgcaagcagcccctggcttattatttcccctttattttannnnnnnaac |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
22590394 |
aaattgaaatggaacgcttttagcaaaaacaggggtgtgcccctcgcaaattgcaagcagcccctggcttattatttcccctttattttatttttttaac |
22590295 |
T |
|
| Q |
100 |
aaaacaccacacattcttttatctcttcttttacaccaattgttatcacacattctctctccaaaacaacagcatcgtacgcttctcttcttcttctcca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22590294 |
aaaacaccacacattcttttatctcttcttttacaccaattgttatcacacattctctctccaaaacaacagcatcgtacgcttctcttcttcttctcca |
22590195 |
T |
|
| Q |
200 |
tgataaccaccaccaccaacttcc |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
22590194 |
tgataaccaccaccaccaacttcc |
22590171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 30934679 - 30934902
Alignment:
| Q |
1 |
aaattgaaatggaacgcttttagcaaaaacaggggtgtgccc-tcggaaattgcaagcagcccctggcttattatttcccctttattttannnnnnnaac |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30934679 |
aaattgaaatggaacgcttttagcaaaaacaggggtgtgcccctcgcaaattgcaagcagcccctggcttattatttcccctttattttatttttttaac |
30934778 |
T |
|
| Q |
100 |
aaaacaccacacattcttttatctcttcttttacaccaattgttatcacacattctctctccaaaacaacagcatcgtacgcttctcttcttcttctcca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
30934779 |
aaaacaccacacattcttttatctcttcttttacaccaattgttatcacacattctctctccaaaacaacagcatcgtacacttctcatcttcttctcca |
30934878 |
T |
|
| Q |
200 |
tgataaccaccaccaccaacttcc |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
30934879 |
tgataaccaccaccaccaacttcc |
30934902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University