View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10349_high_10 (Length: 333)

Name: NF10349_high_10
Description: NF10349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10349_high_10
NF10349_high_10
[»] chr4 (3 HSPs)
chr4 (1-319)||(48951803-48952121)
chr4 (109-198)||(48974784-48974873)
chr4 (59-99)||(48911698-48911738)
[»] scaffold0536 (3 HSPs)
scaffold0536 (50-285)||(803-1038)
scaffold0536 (59-195)||(9848-9984)
scaffold0536 (59-195)||(5864-6000)


Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 319
Target Start/End: Complemental strand, 48952121 - 48951803
Alignment:
1 cgatgaaggctggaaaatctaccatgccaccacactgctccatggactaattgagaatttcgtggagcagcacccacctgattgtatcgtggcggatttt 100  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
48952121 cgatgaaggctggaaaatctaccatgccaccacactgctccacggactaattgagaatttcgtggagcagcacccacctgattgcatcgtggcggatttt 48952022  T
101 ttattcccgtgggcggatgagctagcaaagaagcttcacattccgagattcgtgttcaatggtttctcactctttaccatatgtgccatggaatccctca 200  Q
    |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
48952021 ttattcccgtgggctgatgagctagcaaagaagctgcacattccgagattcgtgttcaacggtttctcactctttaccatatgtgccatggaatccctca 48951922  T
201 aatcacaccctctccctgaggatgcttctggttcttttgttattccgaattttccttacgacattgtcattaattcaacaccacccttggagtccaagtc 300  Q
    |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
48951921 aattgcaccctctccctgaggatgcttctggttcttttgttattccgaattttccttacgatattgtcattaattcaacaccacccttggagtccaagtc 48951822  T
301 ttttatggatcctctgctc 319  Q
    |||||||||||||||||||    
48951821 ttttatggatcctctgctc 48951803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 109 - 198
Target Start/End: Complemental strand, 48974873 - 48974784
Alignment:
109 gtgggcggatgagctagcaaagaagcttcacattccgagattcgtgttcaatggtttctcactctttaccatatgtgccatggaatccct 198  Q
    ||||| ||||||| | ||||| |  ||||||||||| ||| |||  ||||| ||||||||||||||| ||||||||||||||||||||||    
48974873 gtgggtggatgagttggcaaacagacttcacattcccagactcgccttcaacggtttctcactctttgccatatgtgccatggaatccct 48974784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 59 - 99
Target Start/End: Original strand, 48911698 - 48911738
Alignment:
59 ttcgtggagcagcacccacctgattgtatcgtggcggattt 99  Q
    |||||||||||||||||||| ||||| |||||||| |||||    
48911698 ttcgtggagcagcacccaccagattgcatcgtggctgattt 48911738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0536 (Bit Score: 156; Significance: 7e-83; HSPs: 3)
Name: scaffold0536
Description:

Target: scaffold0536; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 50 - 285
Target Start/End: Original strand, 803 - 1038
Alignment:
50 attgagaatttcgtggagcagcacccacctgattgtatcgtggcggattttttattcccgtgggcggatgagctagcaaagaagcttcacattccgagat 149  Q
    ||||||||||||||||| ||| | ||||||||||| ||||| ||||||||||||||||| |||| ||||||||| ||||| |||||||||||||||||||    
803 attgagaatttcgtggaacaggaaccacctgattgcatcgtagcggattttttattcccttgggtggatgagctggcaaacaagcttcacattccgagat 902  T
150 tcgtgttcaatggtttctcactctttaccatatgtgccatggaatccctcaaatcacaccctctccctgaggatgcttctggttcttttgttattccgaa 249  Q
    | |  ||||| ||||||||||| |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||    
903 ttgccttcaacggtttctcactatttaccatatgtgccatggaatcccttaaatcacaacctctccctgaggatgcttctggttcttttgttattccgaa 1002  T
250 ttttccttacgacattgtcattaattcaacaccacc 285  Q
    |||||||||||| ||  |||||||||||| ||||||    
1003 ttttccttacgatatcatcattaattcaaaaccacc 1038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0536; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 59 - 195
Target Start/End: Original strand, 9848 - 9984
Alignment:
59 ttcgtggagcagcacccacctgattgtatcgtggcggattttttattcccgtgggcggatgagctagcaaagaagcttcacattccgagattcgtgttca 158  Q
    |||||||||||||||||||| ||||| |||||| | |||||||| || || ||||  ||||| || ||||| |||||||| ||||| ||| ||   ||||    
9848 ttcgtggagcagcacccaccggattgcatcgtgacagattttttgtttccttgggttgatgaacttgcaaacaagcttcaaattccaagactctctttca 9947  T
159 atggtttctcactctttaccatatgtgccatggaatc 195  Q
    | |||||||| || ||| | || ||||||||||||||    
9948 acggtttctctctgtttgctatttgtgccatggaatc 9984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0536; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 59 - 195
Target Start/End: Original strand, 5864 - 6000
Alignment:
59 ttcgtggagcagcacccacctgattgtatcgtggcggattttttattcccgtgggcggatgagctagcaaagaagcttcacattccgagattcgtgttca 158  Q
    |||||||||||||||||||| ||||| || ||||||||||| || || || ||||  ||||| || ||||| |||||||| ||||| ||| ||   ||||    
5864 ttcgtggagcagcacccaccggattgcattgtggcggatttcttgtttccttgggttgatgaacttgcaaacaagcttcaaattcctagactcagtttca 5963  T
159 atggtttctcactctttaccatatgtgccatggaatc 195  Q
    | |||||||| || ||| | || |||||||| |||||    
5964 acggtttctctctgtttgcaatttgtgccatagaatc 6000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University