View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10349_high_23 (Length: 224)
Name: NF10349_high_23
Description: NF10349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10349_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 22 - 212
Target Start/End: Original strand, 11445725 - 11445915
Alignment:
| Q |
22 |
cacgcatgccttttggactgatttggcaactcgttcttatatacttctcccctttgtggctcagacatgctagtcttacctccagcaataggaaaatcta |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11445725 |
cacgcatgccttttggactgatttggcaactcgttcttatatacttctcccctttgtggctcagacatgctagtcttacctccagcaataggaaaatcta |
11445824 |
T |
|
| Q |
122 |
aatattctaaactatcatttgaattctctaagtacttgtgattttcaattccttcttctacaaatctccacttatgtgaatctctgctcct |
212 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11445825 |
aatattctgaactatcatttgagttctctaagtacttgtgattttcaattccttcttctacaaatctccacttatgtgaatctctgttcct |
11445915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University