View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10349_low_13 (Length: 349)
Name: NF10349_low_13
Description: NF10349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10349_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 5657193 - 5657468
Alignment:
| Q |
1 |
cccggcagattgggttaaattttcttcctaaaaatggttcctttggtaaaatgtctggaagcactactctttttatgagtcgaaggggaaacttgtattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5657193 |
cccggcagattgggttaaattttcttcctaaaaatggttcctttggtaaaatgtctggaagcactactctttttataagtcgaaggggaaacttgtattg |
5657292 |
T |
 |
| Q |
101 |
taatggaacttatagggtttcgtggtcgtggcggtgtcgggatgtcattctctcaggtgctggccaggatccacttgtacctaccgctcaatggcggttt |
200 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5657293 |
taatggaacttatagggtttcgtagtggtggcggtgtcgggatgtcattctctcaggtgctggccaggatccacttgtacctaccgctcaatggcggttt |
5657392 |
T |
 |
| Q |
201 |
gttctgattcctttcttctggagggacttggtgttctttggttcggtgggtgctttcttggcaggtctttcccggc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5657393 |
gttctgattcctttcttctggagggacttggtgttctttggttcggtgggtgctttcttggcaggtctttcccggc |
5657468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University