View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10349_low_20 (Length: 259)
Name: NF10349_low_20
Description: NF10349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10349_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 20 - 201
Target Start/End: Original strand, 47713143 - 47713324
Alignment:
| Q |
20 |
ttcgccgcatccctcaccgcaatctcttcactcatcaaagagtcttcatcggtataatcgtgaagtaccgaaaaggggttttggattttcttaaccggag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47713143 |
ttcgccgcatccctcaccgcaatctcttcactcatcaaagagtcttcatcagtataatcgtgaagtaccgaaaaggggttttggattttcttaaccagag |
47713242 |
T |
 |
| Q |
120 |
ggggtttaacttgaaccaaagggggtttaaactcccattgttcttgatcgaattttctaacaccaaaacgggtttttgattt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
47713243 |
ggggtttaacttgaaccaaagggggtttaaactcccattgttcttgatcgaattttcttacaccaaagcgggtttttgattt |
47713324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 215 - 250
Target Start/End: Original strand, 47713356 - 47713391
Alignment:
| Q |
215 |
ctgtaggctgctaatttcttttgattccattcttct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47713356 |
ctgtaggctgctaatttcttttgattccattcttct |
47713391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University