View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10349_low_24 (Length: 253)
Name: NF10349_low_24
Description: NF10349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10349_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 11 - 238
Target Start/End: Original strand, 41725141 - 41725368
Alignment:
| Q |
11 |
cacagacaaacaaaaatacagaacctccctgtatactaatgctaagtaacaccaaaatagttttagacaggaggtcaaaagttcaaattctagaagtaac |
110 |
Q |
| |
|
|||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41725141 |
cacaaacaaaaaaaaatacagaacctccctgaatactaatgctaagtaacaccaaaatagttttagataggaggtcaaaagttcaaattctagaagtaac |
41725240 |
T |
|
| Q |
111 |
tactaacttaataagtcattcaaacttataaaaaggataatcaatcattttgatctttaaacgtgtgaggtgttgtcattatagtcactgagtgaatcga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
41725241 |
tactaacttaataagtcattcaaacttataaaaaggataatcaatcattttgatctttgaatgtgtgaagtgttgttattatagtcactgagtgaatcga |
41725340 |
T |
|
| Q |
211 |
attacaagcacatctacatgtttttctt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41725341 |
attacaagcacatctacatgtttttctt |
41725368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University