View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10349_low_27 (Length: 244)
Name: NF10349_low_27
Description: NF10349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10349_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 4e-62; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 97 - 225
Target Start/End: Complemental strand, 5656860 - 5656733
Alignment:
| Q |
97 |
tttgacagtgagttatatgtggttcttaccactttgtctacagagaaaaaataaacttgtatatacttccatttattatttttgtatctttaattaagtt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5656860 |
tttgacagtgagttatatgtggttcttaccactttgtctacagagaaaaaataaacttgtatatacttccatttattatttttgtatctttaattaagtt |
5656761 |
T |
|
| Q |
197 |
cttatttatgttttggcaggaactcacgg |
225 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
5656760 |
cttatttatg-tttggcaggaactcacgg |
5656733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 169 - 223
Target Start/End: Complemental strand, 5686257 - 5686203
Alignment:
| Q |
169 |
ttattatttttgtatctttaattaagttcttatttatgttttggcaggaactcac |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5686257 |
ttattatttttgtatctttaattaagttcttatttatgttttggcaggaactcac |
5686203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 169 - 223
Target Start/End: Complemental strand, 5718404 - 5718350
Alignment:
| Q |
169 |
ttattatttttgtatctttaattaagttcttatttatgttttggcaggaactcac |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5718404 |
ttattatttttgtatctttaattaagttcgtatttatgttttggcaggaactcac |
5718350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 5656956 - 5656919
Alignment:
| Q |
1 |
atgaaaatggttttgataacctagatcaacttacttgc |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5656956 |
atgaaaatggttttgataacctagatcaacttacttgc |
5656919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 5718698 - 5718661
Alignment:
| Q |
1 |
atgaaaatggttttgataacctagatcaacttacttgc |
38 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
5718698 |
atgaaaatggtcttgataacctagaccaacttacttgc |
5718661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University