View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10349_low_31 (Length: 239)
Name: NF10349_low_31
Description: NF10349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10349_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 42780866 - 42781089
Alignment:
| Q |
1 |
cctgatccgtctgttgatgattgggttggagttttctctcctgcaaatttcaagtaatgcatatctatctagtgttgaagtatgcacatgtaattaatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42780866 |
cctgatccgtctgttgatgattgggttggagttttctctcctgcaaatttcaagtaatgcatatctatctagtgttgaagtatgcacatgtaattaatgc |
42780965 |
T |
|
| Q |
101 |
taaaagataaagtaaatctgtattttcattctcgaaattgtaaggatcg-tgcaatttagtcgatcaaatttgtgaaatatgtagcaatttagtctctta |
199 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42780966 |
taaaagataaagtaaatcggtattttcattctcgaaattgtaaggatcgaggcaatttagtcgatcaaatttgtgaattatgtagcaatttagtctctta |
42781065 |
T |
|
| Q |
200 |
aattgaagacagtcaatttggtac |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42781066 |
aattgaagacagtcaatttggtac |
42781089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University