View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10349_low_37 (Length: 216)
Name: NF10349_low_37
Description: NF10349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10349_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 13 - 202
Target Start/End: Complemental strand, 37845351 - 37845162
Alignment:
| Q |
13 |
tcataaacttcctcaaacagtgtgtctatgtcagtagataagcgtaaataagtttaatccaaacaggcccaaggattgcagctaaactagtttgtcatga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37845351 |
tcataaacttcctcaaacagtgtgtctatgtcagtagataagcgtaaataagtttaatccaaacaggcccaaggattgcagctaaactagtttgtcatga |
37845252 |
T |
 |
| Q |
113 |
gctattgttttcatgattatgcgtttatgcttctaagtcnnnnnnnnttgcagctaaactagtttgtcaattggcaaggttttccaacgt |
202 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37845251 |
gctattgttttcatgattatgcatttatgcttctaagtcaaaaaaaattgcagctaaactagtttgtcaattggcaaggttttccaacgt |
37845162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University