View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1034_low_9 (Length: 251)
Name: NF1034_low_9
Description: NF1034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1034_low_9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 12 - 251
Target Start/End: Complemental strand, 43029469 - 43029230
Alignment:
| Q |
12 |
atgaagccttggaatgctattcacactgttgttattgctgttgatgttattgaagaaactattactatggctgctgaaattagcaaaccaaatagggata |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43029469 |
atgaagccttggaatgctattcacactgttgttattgctgttgatgttattgaagaaactattactatggctgctgaaattagcaaaccaaatagggata |
43029370 |
T |
|
| Q |
112 |
gttacggttgatcttttcaatttcttgtgatccctaatggtttcagtttcatgatcagaaaatggattaaggatccatgttgaagtagcactgttttcta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43029369 |
gttacggttgatcttttcaatttcttgtgatccctaatggtttcagtttcatgatcagaaaatggattaaggatccatgttgaagtagcactgttttcta |
43029270 |
T |
|
| Q |
212 |
aaataggcaaatttggatataaagaagcatagtaagaacc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43029269 |
aaataggcaaatttggatataaagaagcatagtaagaacc |
43029230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University