View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10350_high_10 (Length: 238)
Name: NF10350_high_10
Description: NF10350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10350_high_10 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 6100203 - 6100426
Alignment:
| Q |
1 |
tgatagttttgaagtacttgttggttttgtcacgtagaggactccatgctgagtatttattccctttaactatatagttatcatgtgtttagtgttttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6100203 |
tgatagttttgaagtacttgttggttttgtcacgtagaggactccatgctgagtatttattccctttaactatatagttatcatgtgtttagtgctttgt |
6100302 |
T |
 |
| Q |
101 |
agatatgaacatgcctttttctacggtcttcattttgagtatgtattatacttatgaatcctagcttttatttttcttcagtgttcatgaaaacatggta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6100303 |
agatatgaacatgcctttttctacggtcttcattttgagtatttattatacttatgaatcctagcttttatttttcttcagtgttcatgaaaacatggta |
6100402 |
T |
 |
| Q |
201 |
aatataggtgaatggggtaaataa |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6100403 |
aatataggtgaatggggtaaataa |
6100426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 7 - 220
Target Start/End: Complemental strand, 364583 - 364375
Alignment:
| Q |
7 |
ttttgaagtacttgttggttttgtcacgtagaggactccatgctgagtatttattccctttaactatatagttatcatgtgtttagtgttttgtagatat |
106 |
Q |
| |
|
|||| ||||| ||| || |||||||| |||||||||||||| |||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
364583 |
ttttaaagtagttgatgattttgtcatctagaggactccatgttgagtatt----ccctttaactatatagttaacatgtgtttagtgttttgtagatat |
364488 |
T |
 |
| Q |
107 |
gaacatgcctttttctacggtcttcattttgagtatgtattatacttatgaatcctagcttttatttttcttcagtgttcatgaaaacatggtaaatata |
206 |
Q |
| |
|
||||||||| |||| || |||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
364487 |
gaacatgccctttt-tatggtcttcattttgagtatttattatacttatgaatcctaacttttatttttcttcggtgttcatgaaaacatggtaaatata |
364389 |
T |
 |
| Q |
207 |
ggtgaatggggtaa |
220 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
364388 |
ggtgaatggggtaa |
364375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University