View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10350_high_14 (Length: 206)
Name: NF10350_high_14
Description: NF10350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10350_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 34583658 - 34583479
Alignment:
| Q |
18 |
caagcaccatgaaatccaactttctaggcttttggttccattatctatggtagcatcggtaggacagaggataaat--gttctaagaaacgttggagaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
34583658 |
caagcaccatgaaatccaactttctaggcttttggttccattatctatggtagcatcggtaggacagaggataaatatgttctaagaaaccttggagaat |
34583559 |
T |
 |
| Q |
116 |
gtgaattaattgataacgaggtcaactgtagggatatccaaactgctgccggcaatatcaattgttcccccctcttctct |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34583558 |
gtgaattaattgataacgaggtcaactgtagggatatccaaactgctgccggcaatatcaattgttcccccctcttctct |
34583479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 34577534 - 34577455
Alignment:
| Q |
18 |
caagcaccatgaaatccaactttctaggcttttggttccattatctatggtagcatcggtaggacagaggataaatgttc |
97 |
Q |
| |
|
|||||||||||||||||| ||| | || |||||||||||||||||||| |||||| ||||||||||| |||||||||| |
|
|
| T |
34577534 |
caagcaccatgaaatccattttttttggattttggttccattatctatgttagcattggtaggacagataataaatgttc |
34577455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University