View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10350_low_12 (Length: 286)
Name: NF10350_low_12
Description: NF10350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10350_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 43 - 213
Target Start/End: Complemental strand, 4458498 - 4458328
Alignment:
| Q |
43 |
gttggtgatgaaactgatgtttgggacaagatagagccaaatttgatcaatctatttgacattgaaagtatggtgaaacattttatgggttaccacaata |
142 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
4458498 |
gttggtgatgaaactgatgtttggggcaagatagagccaaatttgatcaatctatttgacattgaaagtatggtgaaacattgtaggggttaccacaata |
4458399 |
T |
|
| Q |
143 |
ttgttatgatttcttacttgaagttgtataaaggtatgaaattggatctgaatatttgtgaatgtcgtaag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
4458398 |
ttgttatgatttcttacttgaagttgtataaaggtatgaaattgaatctgaatatttgtaaatgtcgtaag |
4458328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 97 - 201
Target Start/End: Complemental strand, 17541999 - 17541895
Alignment:
| Q |
97 |
tttgacattgaaagtatggtgaaacattttatgggttaccacaatattgttatgatttcttacttgaagttgtataaaggtatgaaattggatctgaata |
196 |
Q |
| |
|
||||| ||||||||| |||||||||||| || ||||||||||| |||| || | |||||| ||||| |||||||||| ||| || ||||| |||| |
|
|
| T |
17541999 |
tttgagattgaaagtttggtgaaacattgtaagggttaccacataattgctaaattgtcttacatgaagccgtataaaggtgtgacatctgatctcaata |
17541900 |
T |
|
| Q |
197 |
tttgt |
201 |
Q |
| |
|
||||| |
|
|
| T |
17541899 |
tttgt |
17541895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University