View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10350_low_17 (Length: 238)
Name: NF10350_low_17
Description: NF10350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10350_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 12 - 116
Target Start/End: Complemental strand, 33499899 - 33499795
Alignment:
| Q |
12 |
tgagatgaattatgttgaggggtgtggttgattaatgtagataggatttattcaagtgtcccaacagagtgagaagtggggaatgtacaatgctgaaatg |
111 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33499899 |
tgagatgaattatgttaaggggtgtggttgattactgtagataggatttattcaagtgtcccaacagagtgagacgtggggaatgtacaatgctgaaatg |
33499800 |
T |
|
| Q |
112 |
agttc |
116 |
Q |
| |
|
||||| |
|
|
| T |
33499799 |
agttc |
33499795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 220
Target Start/End: Complemental strand, 33499732 - 33499673
Alignment:
| Q |
169 |
attggaaactcataatagtagacac--------aaggaggtccctcttcgacggagttga |
220 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33499732 |
attggaaactcataatagtagacacttaaatacaaggaggtccctcttcgacggagttga |
33499673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University