View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10350_low_19 (Length: 238)
Name: NF10350_low_19
Description: NF10350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10350_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 56 - 225
Target Start/End: Complemental strand, 8249671 - 8249517
Alignment:
| Q |
56 |
atcttttcttaattttctgaagttttccgccactttgtttgcccatgtacttgatgtatgtttttgcaaagttgaggaactcattataaatctgggatct |
155 |
Q |
| |
|
|||||||||||||||| |||||||||| || ||||||||||||| ||| |||||||||||||||| | ||||||||||||||| |||| |||||||| |
|
|
| T |
8249671 |
atcttttcttaattttatgaagttttctgc-actttgtttgccctcgtatctgatgtatgtttttgcgaggttgaggaactcattgaaaatatgggatct |
8249573 |
T |
|
| Q |
156 |
ttgaatacaatagctttgtgaaagttaattctttgtcgaagacctatttctagcaaatataatttcatct |
225 |
Q |
| |
|
|||| ||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8249572 |
ttgaccacaatag--------------attctttgtcgaagacctgtttctagcaaatataatttcatct |
8249517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 8249761 - 8249710
Alignment:
| Q |
1 |
tttcttccttgcatttatcctaatttggcctcctggagcattcttgttgagg |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
8249761 |
tttcttccttgcatttatcctaatttggcctcttggagcattcttattgagg |
8249710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University