View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10350_low_20 (Length: 235)
Name: NF10350_low_20
Description: NF10350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10350_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 4 - 214
Target Start/End: Complemental strand, 47120848 - 47120638
Alignment:
| Q |
4 |
ggatgtgtgcgctgcaaatctcgatctatctgttccgctatctctgtatgctagaaaatgggtagccggtgatatgtatctacttcattatcttgaaggc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47120848 |
ggatgtgtgcgctgcaaatctcgatctatctgttctgctatctctgtatgctagaaaatgggtagccggtgatatgtatccacttcattatcttgaaggc |
47120749 |
T |
 |
| Q |
104 |
gtccaaagtaactataaaatggagaagaaactaacctgaaaatattgtctccaaagactttccttatcgaggctcaaagggtgatcttccacgggaattt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47120748 |
gtccaaagtaactataaaatggagaagaaactaacctgaaaatattgtctccaaagactttccttatcgaggctcaaagggtgatcttccacgggaattt |
47120649 |
T |
 |
| Q |
204 |
catgtcgcctg |
214 |
Q |
| |
|
||||||||||| |
|
|
| T |
47120648 |
catgtcgcctg |
47120638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University