View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10351_high_12 (Length: 229)
Name: NF10351_high_12
Description: NF10351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10351_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 210
Target Start/End: Complemental strand, 12367354 - 12367160
Alignment:
| Q |
16 |
aagaagattagagatagcatgaaatttcatgtatatattaagttgcagaaaatatataatgagaatgagggcttcaatctcatgattaaaatctaaatat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12367354 |
aagaagattagagatagcatgaaatttcatgtatatattaagttgcagcaaatataaaatgagaatgagggcttcaatctcatgattaaaatctagatat |
12367255 |
T |
|
| Q |
116 |
ttaactttattattcggtaatttaaaaaagattataattttgtttttcattcatgatccctagcttggtcatatccattatgattcacaccacct |
210 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12367254 |
ttaactttattattcggtaatgtaaaaaagattataattttgtttttcattcatgatccctagcttggtcatatccattatgattcataccacct |
12367160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University