View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10351_high_5 (Length: 392)
Name: NF10351_high_5
Description: NF10351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10351_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 2 - 268
Target Start/End: Complemental strand, 42956359 - 42956093
Alignment:
| Q |
2 |
ggtaacatcagtaacaatgatgtctcaataccgcagaaaaacatattgatgaacgactgcattttatcagagacatatttgtatgacggttacttgaagt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42956359 |
ggtaacatcagtaacaatgatgtctcaataccgcagaaaaacatattgatgaaagacagcattttatcagagacatatttgtatgacggttacttgaagt |
42956260 |
T |
 |
| Q |
102 |
gaagaaagttgttggtgaagacaatcgagctaacttgttaaccaaggtggttcctagatccaattttttgcattgcttgaccggtaaatctagatacctg |
201 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42956259 |
gaagaaagttgtcggtgaagacaatcgagctaacttgttaaccaaggtggttcccagatccaattttttgcattgcttgaccggtaaatctagatacctg |
42956160 |
T |
 |
| Q |
202 |
cgagagttgaattctcaaaagttgtgaacactttaggctatcactatcttaattcattgtgtttcag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42956159 |
cgagagttgaattctcaaaagttgtgaacactttaggctatcactatcttaattcattgtgtttcag |
42956093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 295 - 381
Target Start/End: Complemental strand, 42956095 - 42956009
Alignment:
| Q |
295 |
caggatcattaattgtgtttacaatttaccaagttagtttttgcttatgttttttataaaagctgttgcgataacatctttgttcat |
381 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42956095 |
caggatcactaattgtgtttacaatttaccaagttagattttgcctatgttttttataaaagctgttgcgataacatctttgttcat |
42956009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University